jessicalumian
    • Create new note
    • Create a note from template
      • Sharing URL Link copied
      • /edit
      • View mode
        • Edit mode
        • View mode
        • Book mode
        • Slide mode
        Edit mode View mode Book mode Slide mode
      • Customize slides
      • Note Permission
      • Read
        • Only me
        • Signed-in users
        • Everyone
        Only me Signed-in users Everyone
      • Write
        • Only me
        • Signed-in users
        • Everyone
        Only me Signed-in users Everyone
    • Invite by email
      Invitee

      This note has no invitees

    • Publish Note

      Share your work with the world Congratulations! 🎉 Your note is out in the world Publish Note No publishing access yet

      Your note will be visible on your profile and discoverable by anyone.
      Your note is now live.
      This note is visible on your profile and discoverable online.
      Everyone on the web can find and read all notes of this public team.

      Your account was recently created. Publishing will be available soon, allowing you to share notes on your public page and in search results.

      Your team account was recently created. Publishing will be available soon, allowing you to share notes on your public page and in search results.

      Explore these features while you wait
      Complete general settings
      Bookmark and like published notes
      Write a few more notes
      Complete general settings
      Write a few more notes
      See published notes
      Unpublish note
      Please check the box to agree to the Community Guidelines.
      View profile
    • Commenting
      Permission
      Disabled Forbidden Owners Signed-in users Everyone
    • Enable
    • Permission
      • Forbidden
      • Owners
      • Signed-in users
      • Everyone
    • Suggest edit
      Permission
      Disabled Forbidden Owners Signed-in users Everyone
    • Enable
    • Permission
      • Forbidden
      • Owners
      • Signed-in users
    • Emoji Reply
    • Enable
    • Versions and GitHub Sync
    • Note settings
    • Note Insights New
    • Make a copy
    • Transfer ownership
    • Delete this note
    • Save as template
    • Insert from template
    • Import from
      • Dropbox
      • Google Drive
      • Gist
      • Clipboard
    • Export to
      • Dropbox
      • Google Drive
      • Gist
    • Download
      • Markdown
      • HTML
      • Raw HTML
Menu Note settings Note Insights Versions and GitHub Sync Sharing URL Create Help
Create Create new note Create a note from template
Menu
Options
Make a copy Transfer ownership Delete this note
Import from
Dropbox Google Drive Gist Clipboard
Export to
Dropbox Google Drive Gist
Download
Markdown HTML Raw HTML
Back
Sharing URL Link copied
/edit
View mode
  • Edit mode
  • View mode
  • Book mode
  • Slide mode
Edit mode View mode Book mode Slide mode
Customize slides
Note Permission
Read
Only me
  • Only me
  • Signed-in users
  • Everyone
Only me Signed-in users Everyone
Write
Only me
  • Only me
  • Signed-in users
  • Everyone
Only me Signed-in users Everyone
  • Invite by email
    Invitee

    This note has no invitees

  • Publish Note

    Share your work with the world Congratulations! 🎉 Your note is out in the world Publish Note No publishing access yet

    Your note will be visible on your profile and discoverable by anyone.
    Your note is now live.
    This note is visible on your profile and discoverable online.
    Everyone on the web can find and read all notes of this public team.

    Your account was recently created. Publishing will be available soon, allowing you to share notes on your public page and in search results.

    Your team account was recently created. Publishing will be available soon, allowing you to share notes on your public page and in search results.

    Explore these features while you wait
    Complete general settings
    Bookmark and like published notes
    Write a few more notes
    Complete general settings
    Write a few more notes
    See published notes
    Unpublish note
    Please check the box to agree to the Community Guidelines.
    View profile
    Engagement control
    Commenting
    Permission
    Disabled Forbidden Owners Signed-in users Everyone
    Enable
    Permission
    • Forbidden
    • Owners
    • Signed-in users
    • Everyone
    Suggest edit
    Permission
    Disabled Forbidden Owners Signed-in users Everyone
    Enable
    Permission
    • Forbidden
    • Owners
    • Signed-in users
    Emoji Reply
    Enable
    Import from Dropbox Google Drive Gist Clipboard
       Owned this note    Owned this note      
    Published Linked with GitHub
    • Any changes
      Be notified of any changes
    • Mention me
      Be notified of mention me
    • Unsubscribe
    # Intro to Shell Lesson Materials from: [Data Carpentry Intro to Shell](https://hackmd.io/MwIwZgLAJgrA7HAtANmADgKaIgTisRAQ0JAMIGNC4AGE8uCZHIA=) Helpful Links: * [Shell Basic Commands](https://github.com/swcarpentry/DEPRECATED-boot-camps/blob/master/shell/shell_cheatsheet.md) * [Shell Cheatsheet](https://fosswire.com/post/2007/08/unixlinux-command-cheat-sheet/) * [Explain Shell](https://explainshell.com) # The Shell ## Learning Objectives * Describe what the shell is and how it is used. * Summarize reasons why learning the shell is beneficial. --- ## What is the shell? The *shell* is a program that presents a command line interface which allows you to control your computer using commands entered with a keyboard instead of controlling graphical user interfaces (GUIs) with a mouse/keyboard combination. There are many reasons to learn about the shell. * For most bioinformatics tools, you have to use the shell. There is no graphical interface. If you want to work in metagenomics or genomics you're going to need to use the shell. * The shell gives you *power*. The command line gives you the power to do your work more efficiently and more quickly. When you need to do things tens to hundreds of times, knowing how to use the shell is transformative. * To use remote computers or cloud computing, you need to use the shell. --- ![Automation](img/gvng.jpg) Unix is user-friendly. It's just very selective about who its friends are. --- ## How to access the shell The shell is already available on Mac and Linux. For Windows, you'll have to download a separate program. Mac --- On Mac the shell is available through Terminal Applications -> Utilities -> Terminal Go ahead and drag the Terminal application to your Dock for easy access. Windows ------- For Windows, we're going to be using gitbash. Download and install [gitbash](http://msysgit.github.io) on your computer. Open up the program. --- ## Starting with the shell We will spend most of our time learning about the basics of the shell by manipulating some experimental data. Now we're going to download the data for the tutorial. For this you'll need internet access, because you're going to get it off the web. Open the shell. Enter the command: ``` git clone https://github.com/edamame-course/edamame-data.git ``` This command will grab all of the data needed for this workshop from the internet. (We're not going to talk about git right now, but it's a tool for doing version control.) --- Now let's go in to that directory ``` cd cd edamame-data ``` The command `cd` stands for 'change directory' In this directory, there should be some things we just downloaded. Let's check. Type: ``` ls ``` ls stands for 'list' and it lists the contents of a directory. There's a few directories there, but not too many. Let's go look in the data directory. ``` cd shell ls ``` In there, all mixed up together are files and directories/folders. If we want to know which is which, we can type: ``` ls -F ``` Anything with a `"/"` after it is a directory. Things with a `""` after them are programs. If there's nothing there it's a file. You can also use the command `ls -l` to see whether items in a directory are files or directories. `ls -l` gives a lot more information too, such as the size of the file So, we can see that we have several files, directories and a program. Great! ## Arguments Most programs take additional arguments that control their exact behavior. For example, `-F` and `-l` are arguments to `ls`. The `ls` program, like many programs, take a lot of arguments. But how do we know what the options are to particular commands? Most commonly used shell programs have a manual. You can access the manual using the `man` program. Try entering: ``` man ls ``` This will open the manual page for `ls`. Use the space key to go forward and b to go backwards. When you are done reading, just hit `q` to quit. Programs that are run from the shell can get extremely complicated. To see an example, open up the manual page for the `find` program. No one can possibly learn all of these arguments, of course. So you will probably find yourself referring back to the manual page frequently. ## The Unix directory file structure (a.k.a. where am I?) As you've already just seen, you can move around in different directories or folders at the command line. Why would you want to do this, rather than just navigating around the normal way. When you're working with bioinformatics programs, you're working with your data and it's key to be able to have that data in the right place and make sure the program has access to the data. Many of the problems people run in to with command line bioinformatics programs is not having the data in the place the program expects it to be. ## Moving around the file system Let's practice moving around a bit. We're going to work in that `shell` directory we just downloaded. First let's navigate there using the regular way by clicking on the different folders. First we did something like go to the folder of our username. Then we opened `'edamame-data'` then `'shell'` Let's draw out how that went. **Harriet draw image** Now let's draw some of the other files and folders we could have clicked on. This is called a hierarchical file system structure, like an upside down tree with root (/) at the base that looks like this. *** **Exercise** Now we're going to try a hunt. Move around in the 'hidden' directory and try to find the file `'youfoundit.txt'` *** ## Examining the contents of other directories By default, the `ls` commands lists the contents of the working directory (i.e. the directory you are in). You can always find the directory you are in using the `pwd` command. However, you can also give `ls` the names of other directories to view. Navigate to the home directory if you are not already there. Type: ``` cd ``` Then enter the command: ``` ls edamame-data ``` This will list the contents of the `edamame-data` directory without you having to navigate there. The `cd` command works in a similar way. Try entering: ``` cd cd edamame-data/shell/hidden ``` and you will jump directly to `hidden` without having to go through the intermediate directory. **** **Exercise** Try finding the `'anotherfile.txt'` file without changing directories. **** ### Shortcut: Tab Completion Navigate to the home directory. Typing out directory names can waste a lot of time. When you start typing out the name of a directory, then hit the tab key, the shell will try to fill in the rest of the directory name. For example, enter: ``` cd e<tab> ``` The shell will fill in the rest of the directory name for `edamame-data`. Now go to edamame-data/shell/MiSeq ``` ls C01<tab><tab> ``` When you hit the first tab, nothing happens. The reason is that there are multiple directories in the home directory which start with `C01`. Thus, the shell does not know which one to fill in. When you hit tab again, the shell will list the possible choices. Tab completion can also fill in the names of programs. For example, enter `e<tab><tab>`. You will see the name of every program that starts with an `e`. One of those is `echo`. If you enter `ec<tab>` you will see that tab completion works. ## Saving time with shortcuts, wild cards, and tab completion ### Shortcuts There are some shortcuts which you should know about. Dealing with the home directory is very common. So, in the shell the tilde character, `"~"`, is a shortcut for your home directory. Navigate to the `edamame` directory: ``` cd cd edamame-data cd shell ``` Then enter the command: ``` ls ~ ``` This prints the contents of your home directory, without you having to type the full path. The shortcut `..` always refers to the directory above your current directory. Thus: ``` ls .. ``` prints the contents of the `/home/username/edamame-data`. You can chain these together, so: ``` ls ../../ ``` prints the contents of `/home/username` which is your home directory. Finally, the special directory `.` always refers to your current directory. So, `ls`, `ls .`, and `ls ././././.` all do the same thing, they print the contents of the current directory. This may seem like a useless shortcut right now, but we'll see when it is needed in a little while. To summarize, while you are in the `shell` directory, the commands `ls ~`, `ls ~/.`, `ls ../../`, and `ls /home/username` all do exactly the same thing. These shortcuts are not necessary, they are provided for your convenience. ### Wild cards Navigate to the MiSeq directory using" ``` ~/edamame-data/shell/MiSeq ``` This directory contains our FASTQ files and some other ones we'll need for analyses. If we type `ls`, we will see that there are a bunch of files with long file names. Some of the end with `.fastq`. The `*` character is a shortcut for "everything". Thus, if you enter `ls *`, you will see all of the contents of a given directory. Now try this command: ``` ls *fastq ``` This lists every file that ends with a `fastq`. This command: ``` ls /usr/bin/*.sh ``` Lists every file in `/usr/bin` that ends in the characters `.sh`. We have paired end sequencing, so for every sample we have two files. If we want to just see the list of the files for the forward direction sequencing we can use: ``` ls *R*fastq ``` lists every file in the current directory whose name contains the letter `R`, and ends with `fastq`. There are twenty such files which we would expect because we have 20 samples. So how does this actually work? Well...when the shell (bash) sees a word that contains the `*` character, it automatically looks for filenames that match the given pattern. In this case, it identified four such files. Then, it replaced the `*R*fastq` with the list of files, separated by spaces. What happens if you do `R*fastq`? * * * * **Short Exercise** Do each of the following using a single `ls` command without navigating to a different directory. 1. List all of the files in `/bin` that start with the letter 'c 2. List all of the files in `/bin` that contain the letter 'a' 3. List all of the files in `/bin` that end with the letter 'o' BONUS: List all of the files in '/bin' that contain the letter 'a' or 'c' * * * * ## Command History You can easily access previous commands. Hit the up arrow. Hit it again. You can step backwards through your command history. The down arrow takes your forwards in the command history. `^-C` will cancel the command you are writing, and give you a fresh prompt. `^-R` will do a reverse-search through your command history. This is very useful. You can also review your recent commands with the `history` command. Just enter: ``` history ``` to see a numbered list of recent commands, including this just issues `history` command. You can reuse one of these commands directly by referring to the number of that command. If your history looked like this: ``` 259 ls * 260 ls /usr/bin/*.sh 261 ls *R*fastq ``` then you could repeat command #260 by simply entering: ``` !260 ``` (that's an exclamation mark). * * * * **Short Exercise** 1. Find the line number in your history for the last exercise (listing files in /bin) and reissue that command. * * * * ## Examining Files We now know how to switch directories, run programs, and look at the contents of directories, but how do we look at the contents of files? The easiest way to examine a file is to just print out all of the contents using the program `cat`. Enter the following command: ``` cat C01D01F_sub.fastq ``` This prints out the contents of the `C01D01F_sub.fastq` file. * * * * **Short Exercises** 1. Print out the contents of the `~/edamame-data/shell/MiSeq/Centralia_mapping_files/Collapsed_Centralia_full_map.txt` file. What does this file contain? 2. Without changing directories, (you should still be in `edamame-data`), use one short command to print the contents of all of the files in the `/home/username/edamame-data/shell/MiSeq` directory. * * * * Make sure we're in the right place for the next set of the lessons. We want to be in the `shell` directory. Check if you're there with `pwd` and if not navigate there. One way to do that would be ``` cd ~/edamame-data/shell/MiSeq ``` `cat` is a terrific program, but when the file is really big, it can be annoying to use. The program, `less`, is useful for this case. Enter the following command: ``` less C01D01F_sub.fastq ``` `less` opens the file, and lets you navigate through it. The commands are identical to the `man` program. **Some commands in `less`** | key | action | | ------- | ---------- | | "space" | to go forward | | "b" | to go backwarsd | | "g" | to go to the beginning | | "G" | to go to the end | | "q" | to quit | `less` also gives you a way of searching through files. Just hit the "/" key to begin a search. Enter the name of the word you would like to search for and hit enter. It will jump to the next location where that word is found. Try searching the `dictionary.txt` file for the word "cat". If you hit "/" then "enter", `less` will just repeat the previous search. `less` searches from the current location and works its way forward. If you are at the end of the file and search for the word "cat", `less` will not find it. You need to go to the beginning of the file and search. For instance, let's search for the sequence `1101:14341` in our file. You can see that we go right to that sequence and can see what it looks like. Remember, the `man` program actually uses `less` internally and therefore uses the same commands, so you can search documentation using "/" as well! There's another way that we can look at files, and in this case, just look at part of them. This can be particularly useful if we just want to see the beginning or end of the file, or see how it's formatted. The commands are `head` and `tail` and they just let you look at the beginning and end of a file respectively. ``` head C01D01F_sub.fastq tail C01D01F_sub.fastq ``` The `-n` option to either of these commands can be used to print the first or last `n` lines of a file. To print the first/last line of the file use: ``` head -n 1 C01D01F_sub.fastq tail -n 1 C01D01F_sub.fastq ``` ## Searching files We showed a little how to search within a file using `less`. We can also search within files without even opening them, using `grep`. Grep is a command-line utility for searching plain-text data sets for lines matching a string or regular expression. Let's give it a try! Let's search for that sequence `22029:7208` in the `C01D01F_sub.fastq` file. ``` grep 22029:7208 C01D01F_sub.fastq ``` We get back the whole line that had `'22029:7208'` in it. What if we wanted all four lines, the whole part of that FASTQ sequence, back instead. ``` grep -A 3 22029:7208 C01D01F_sub.fastq ``` The `-A` flag stands for "after match" so it's returning the line that matches plus the three after it. The `-B` flag returns that number of lines before the match. **Exercise** 1. Search for the sequence `'TTATCCGGATTTATTGGGTTTAAAGGGT'` in the `C01D01F_sub.fastq` file and in the output have the sequence name and the sequence. e.g. `@M00967:43:000000000-A3JHG:1:2114:11799:28499 1:N:0:188 TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCAG` 2. Search for that sequence in all the FASTQ files. ## Redirection We're excited we have all these sequences that we care about that we just got from the FASTQ files. That is a really important motif that is going to help us answer our important question. But all those sequences just went whizzing by with grep. How can we capture them? We can do that with something called "redirection". The idea is that we're redirecting the output to the terminal (all the stuff that went whizzing by) to something else. In this case, we want to print it to a file, so that we can look at it later. The redirection command for putting something in a file is `>` Let's try it out and put all the sequences that contain `'TTATCCGGATTTATTGGGTTTAAAGGGT'` from all the files in to another file called `'good-data2.txt'` ``` grep -B 2 TTATCCGGATTTATTGGGTTTAAAGGGT *.fastq > good-data2.txt ``` The prompt should sit there a little bit, and then it should look like nothing happened. But type `ls`. You should have a new file called `good-data2.txt`. Take a look at it and see if it has what you think it should. There's one more useful redirection command that we're going to show, and that's called the pipe command, and it is `|`. It's probably not a key on your keyboard you use very much. What `|` does is take the output that scrolling by on the terminal and then can run it through another command. When it was all whizzing by before, we wished we could just slow it down and look at it, like we can with `less`. Well it turns out that we can! We pipe the `grep` command through `less` ``` grep TTATCCGGATTTATTGGGTTTAAAGGGT *.fastq | less ``` Now we can use the arrows to scroll up and down and use `q` to get out. We can also do something tricky and use the command `wc`. `wc` stands for `word count`. It counts the number of lines or characters. So, we can use it to count the number of lines we're getting back from our `grep` command. And that will magically tell us how many sequences we're finding. We're ``` grep TTATCCGGATTTATTGGGTTTAAAGGGT *.fastq | wc ``` That tells us the number of lines, words and characters in the file. If we just want the number of lines, we can use the `-l` flag for `lines`. ``` grep TTATCCGGATTTATTGGGTTTAAAGGGT *.fastq | wc -l ``` Redirecting is not super intuitive, but it's really powerful for stringing together these different commands, so you can do whatever you need to do. The philosophy behind these command line programs is that none of them really do anything all that impressive. BUT when you start chaining them together, you can do some really powerful things really efficiently. If you want to be proficient at using the shell, you must learn to become proficient with the pipe and redirection operators: `|`, `>`, `>>`. ## Creating, moving, copying, and removing Now we can move around in the file structure, look at files, search files, redirect. But what if we want to do normal things like copy files or move them around or get rid of them. Sure we could do most of these things without the command line, but what fun would that be?! Besides it's often faster to do it at the command line, or you'll be on a remote server like Amazon where you won't have another option. The stability.files file is one that tells us what sample name goes with what sequences. This is a really important file, so we want to make a copy so we don't lose it. Lets copy the file using the `cp` command. The `cp` command backs up the file. Navigate to the `data` directory and enter: ``` cp good-data2.txt good-data2.backup.txt ``` Now `good-data2.backup.txt` has been created as a copy of `good-data2.txt`. Let's make a `backup` directory where we can put this file. The `mkdir` command is used to make a directory. Just enter `mkdir` followed by a space, then the directory name. ``` mkdir backup ``` We can now move our backed up file in to this directory. We can move files around using the command `mv`. Enter this command: ``` mv good-data2.backup.txt backup/ ``` This moves `good-data2.backup.txt` into the directory `backup/` or the full path would be `~/edamame-data/shell/MiSeq/backup` The `mv` command is also how you rename files. Since this file is so important, let's rename it: ``` mv backup/good-data2.backup.txt backup/good-data2.backup_IMPORTANT ``` Now the file name has been changed to good-data2.backup_IMPORTANT. Let's delete the backup file now: ``` rm backup/good-data2.backup_IMPORTANT ``` The `rm` file removes the file. Be careful with this command. It doesn't just nicely put the files in the Trash. They're really gone. * * * * **Short Exercise** Do the following: 1. Rename the `good-data2.backup_IMPORTANT` file to `good-data2.backup.txt`. 2. Create a directory in the `MiSeq` directory called `new` 3. Then, copy the `good-data2.backup.txt` file into `new` * * * * By default, `rm`, will NOT delete directories. You can tell `rm` to delete a directory using the `-r` option. Let's delete that `new` directory we just made. Enter the following command: `rm -r new` ## Running programs Commands like `ls`, `rm`, `echo`, and `cd` are just ordinary programs on the computer. A program is just a file that you can *execute*. The program `which` tells you the location of a particular program. For example: ``` which ls ``` Will return "/bin/ls". Thus, we can see that `ls` is a program that sits inside of the `/bin` directory. Now enter: ``` which find ``` You will see that `find` is a program that sits inside of the `/usr/bin` directory. So ... when we enter a program name, like `ls`, and hit enter, how does the shell know where to look for that program? How does it know to run `/bin/ls` when we enter `ls`. The answer is that when we enter a program name and hit enter, there are a few standard places that the shell automatically looks. If it can't find the program in any of those places, it will print an error saying "command not found". Enter the command: ``` echo $PATH ``` This will print out the value of the `PATH` environment variable. More on environment variables later. Notice that a list of directories, separated by colon characters, is listed. These are the places the shell looks for programs to run. If your program is not in this list, then an error is printed. The shell ONLY checks in the places listed in the `PATH` environment variable. Navigate to the `shell` directory and list the contents. You will notice that there is a program (executable file) called `hello.sh` in this directory. Now, try to run the program by entering: ``` hello.sh ``` You should get an error saying that hello.sh cannot be found. That is because the directory `/home/username/edamame-data/shell` is not in the `PATH`. You can run the `hello.sh` program by entering: ``` ./hello.sh ``` Remember that `.` is a shortcut for the current working directory. This tells the shell to run the `hello.sh` program which is located right here. So, you can run any program by entering the path to that program. You can run `hello.sh` equally well by specifying: ``` /home/username/edamame-data/shell/hello.sh ``` Or by entering: ``` ~/edamame-data/shell/hello.sh ``` When there are no `/` characters, the shell assumes you want to look in one of the default places for the program. # For Future Reference # Finding files The `find` program can be used to find files based on arbitrary criteria. Navigate to the `data` directory and enter the following command: ``` find . -print ``` This prints the name of every file or directory, recursively, starting from the current directory. Let's exclude all of the directories: ``` find . -type f -print ``` This tells `find` to locate only files. Now try these commands: ``` find . -type f -name "*1*" find . -type f -name "*1*" -or -name "*2*" -print find . -type f -name "*1*" -and -name "*2*" -print ``` The `find` command can acquire a list of files and perform some operation on each file. Try this command out: ``` find . -type f -exec grep Volume {} \; ``` This command finds every file starting from `.`. Then it searches each file for a line which contains the word "Volume". The `{}` refers to the name of each file. The trailing `\;` is used to terminate the command. This command is slow, because it is calling a new instance of `grep` for each item the `find` returns. A faster way to do this is to use the `xargs` command: ``` find . -type f -print | xargs grep Volume ``` `find` generates a list of all the files we are interested in, then we pipe them to `xargs`. `xargs` takes the items given to it and passes them as arguments to `grep`. `xargs` generally only creates a single instance of `grep` (or whatever program it is running). ## Where can I learn more about the shell? - Software Carpentry tutorial - [The Unix shell](http://software-carpentry.org/v4/shell/index.html) - The shell handout - [Command Reference](http://files.fosswire.com/2007/08/fwunixref.pdf) - [explainshell.com](http://explainshell.com) - http://tldp.org/HOWTO/Bash-Prog-Intro-HOWTO.html - man bash - Google - if you don't know how to do something, try Googling it. Other people have probably had the same question. - Learn by doing. There's no real other way to learn this than by trying it out. Write your next paper in nano (really emacs or vi), open pdfs from the command line, automate something you don't really need to automate. ## Bonus: **backtick, xargs**: Example find all files with certain text **alias** -> rm -i **variables** -> use a path example **.bashrc** **du** **ln** **ssh and scp** **Regular Expressions** **Permissions** **Chaining commands together**

    Import from clipboard

    Paste your markdown or webpage here...

    Advanced permission required

    Your current role can only read. Ask the system administrator to acquire write and comment permission.

    This team is disabled

    Sorry, this team is disabled. You can't edit this note.

    This note is locked

    Sorry, only owner can edit this note.

    Reach the limit

    Sorry, you've reached the max length this note can be.
    Please reduce the content or divide it to more notes, thank you!

    Import from Gist

    Import from Snippet

    or

    Export to Snippet

    Are you sure?

    Do you really want to delete this note?
    All users will lose their connection.

    Create a note from template

    Create a note from template

    Oops...
    This template has been removed or transferred.
    Upgrade
    All
    • All
    • Team
    No template.

    Create a template

    Upgrade

    Delete template

    Do you really want to delete this template?
    Turn this template into a regular note and keep its content, versions, and comments.

    This page need refresh

    You have an incompatible client version.
    Refresh to update.
    New version available!
    See releases notes here
    Refresh to enjoy new features.
    Your user state has changed.
    Refresh to load new user state.

    Sign in

    Forgot password
    or
    Sign in via Google Sign in via Facebook Sign in via X(Twitter) Sign in via GitHub Sign in via Dropbox Sign in with Wallet
    Wallet ( )
    Connect another wallet

    New to HackMD? Sign up

    By signing in, you agree to our terms of service.

    Help

    • English
    • 中文
    • Français
    • Deutsch
    • 日本語
    • Español
    • Català
    • Ελληνικά
    • Português
    • italiano
    • Türkçe
    • Русский
    • Nederlands
    • hrvatski jezik
    • język polski
    • Українська
    • हिन्दी
    • svenska
    • Esperanto
    • dansk

    Documents

    Help & Tutorial

    How to use Book mode

    Slide Example

    API Docs

    Edit in VSCode

    Install browser extension

    Contacts

    Feedback

    Discord

    Send us email

    Resources

    Releases

    Pricing

    Blog

    Policy

    Terms

    Privacy

    Cheatsheet

    Syntax Example Reference
    # Header Header 基本排版
    - Unordered List
    • Unordered List
    1. Ordered List
    1. Ordered List
    - [ ] Todo List
    • Todo List
    > Blockquote
    Blockquote
    **Bold font** Bold font
    *Italics font* Italics font
    ~~Strikethrough~~ Strikethrough
    19^th^ 19th
    H~2~O H2O
    ++Inserted text++ Inserted text
    ==Marked text== Marked text
    [link text](https:// "title") Link
    ![image alt](https:// "title") Image
    `Code` Code 在筆記中貼入程式碼
    ```javascript
    var i = 0;
    ```
    var i = 0;
    :smile: :smile: Emoji list
    {%youtube youtube_id %} Externals
    $L^aT_eX$ LaTeX
    :::info
    This is a alert area.
    :::

    This is a alert area.

    Versions and GitHub Sync
    Get Full History Access

    • Edit version name
    • Delete

    revision author avatar     named on  

    More Less

    Note content is identical to the latest version.
    Compare
      Choose a version
      No search result
      Version not found
    Sign in to link this note to GitHub
    Learn more
    This note is not linked with GitHub
     

    Feedback

    Submission failed, please try again

    Thanks for your support.

    On a scale of 0-10, how likely is it that you would recommend HackMD to your friends, family or business associates?

    Please give us some advice and help us improve HackMD.

     

    Thanks for your feedback

    Remove version name

    Do you want to remove this version name and description?

    Transfer ownership

    Transfer to
      Warning: is a public team. If you transfer note to this team, everyone on the web can find and read this note.

        Link with GitHub

        Please authorize HackMD on GitHub
        • Please sign in to GitHub and install the HackMD app on your GitHub repo.
        • HackMD links with GitHub through a GitHub App. You can choose which repo to install our App.
        Learn more  Sign in to GitHub

        Push the note to GitHub Push to GitHub Pull a file from GitHub

          Authorize again
         

        Choose which file to push to

        Select repo
        Refresh Authorize more repos
        Select branch
        Select file
        Select branch
        Choose version(s) to push
        • Save a new version and push
        • Choose from existing versions
        Include title and tags
        Available push count

        Pull from GitHub

         
        File from GitHub
        File from HackMD

        GitHub Link Settings

        File linked

        Linked by
        File path
        Last synced branch
        Available push count

        Danger Zone

        Unlink
        You will no longer receive notification when GitHub file changes after unlink.

        Syncing

        Push failed

        Push successfully