BioCoding Work

- [x] # STARS 2021 This pad will be a shared document so that we can quickly share and update materials. ---- ## Important links - Pre-survey: https://www.surveymonkey.com/r/stars-pre - Class Google drive (for sharing files and presentations during the class): https://drive.google.com/drive/folders/1usrO_j2J-XavmGM6qq7MVKs3IlwK2OZE?usp=sharing - Alumni Google Classroom (after you have finished the course!): https://classroom.google.com/c/MjA0MzM1NjcxODY4?cjc=2u6s4nj - Bacterial transformation animation [link](https://content.dnalc.org/content/c15/15918/transformation2-canvas.html) - Poster presentation folder: [link](https://drive.google.com/drive/folders/1eSVMTxuLAprJHN1rQpMwWgcSAHrPn6YK?usp=sharing) - Notebooks: https://github.com/JasonJWilliamsNY/biocoding-2021-notebooks - Zoom link: [link](https://cshl-dnalc.zoom.us/j/5163675186) - JupyterHub: [http://128.196.142.21:8000](http://128.196.142.21:8000) - (Password = lastname.123) - Setup page for Jupyter: [link](https://jasonjwilliamsny.github.io/biocoding-2021-dnalc/setup.html) - Presentation folder: [link](https://drive.google.com/drive/folders/1DNbnkokibhWMuKdNVWBxNKXj074qPW6K?usp=sharing) - Shared photos: [link](https://drive.google.com/drive/folders/1-6kWXZ8rS8Y1eXLk9NzL0-Pla3HHhO4d?usp=sharing) --- ## Wrap up **Pizza Order** - cheese - - Pepperoni-Osa - Pepperoni- Gentiva - Plain - Madison - Sausage- Nile - canned fish- Camile - Banana Pepper, Jayden - Pepperoni - Kenly - regular cheese :) - chrysnell - I really like mozerella sticks but ill do pepperoni if you guys want it - Carlos - EXTRA CHEESE - cheese- Julia - pepperoni- lucas - raisin bread -cheese, i looked up the pepperoni on the place it looked suspicious- Jordan SCHOOLS Your name, your full school name, your prefered email address (non-school if possible) Jayden Hoff Isabell, Huntington High School, yeboijayden@icloud.com Evan Spagnoletti, Huntington High School, vanspaghetti@gmail.com Kenly Moran, Freeport High School, monseken13@gmail.com Madison Krug, Farmingdale High School, madykrug23@gmail.com Gentiva Abrahams, Freeport High School, gentivaabrahams03@gmail.com Julia Rodriguez, Farmingdale High School, jrods5@icloud.com Osaretinmwen Peter Oriakhi, Central Islip High School, osaretinmwenoriakhi@gmail.com Kelly Gaussaint, Central Islip High School, kelz.gaussaint@yahoo.com Chrysnell Destina, Central Islip High School, chrysnelld@gmail.com Lucas Spagnoletti, Huntington High School, lucasspagnoletti2@gmail.com Camille Crumpton, West Hempstead High School, cammi35@icloud.com Jordan Blake, Bard Highschool Early College, jordan.a.b.blake@gmail.com Joshua Paz, Kewforest Highschool, joshmpaz2024@gmail.com Nile Jean, Staples High School, nilenj@icloud.com Carlos Javier Diaz Sanchez, Wyandanch Memorial High School, carlosdiazjavier69@gmail.com --- Command for configuring notebook git clone https://github.com/JasonJWilliamsNY/biocoding-2021-notebooks ---- ## Assignment/homework sign ups **Reading a scientific paper (Due:8/11)**: Choose a paper from the [google drive folder](https://drive.google.com/drive/folders/1V-ZoP3CjXSTDbdJo5KjkKkXfJwbMrP5m?usp=sharing). At a minimum read the abstract (first bolded paragrah), more will be assigned as needed. Put your name and the paper you choose below. Name, Paper chosen - Kenly, prions - Madison, the making of an mRNA - Julia, dissecting the mechanism of rnai - Camille, The tumor suppressor p53 - Gentiva, the making of an mRNA - Kelly, The prion amyloid paper - Chrysnell, The Tumor Suppressor p53 - Nile, The rnai paper - Carlos, The prion amyloid paper - Evan, The Tumor Suppressor pg53 - Lucas, the Discovery of Telemorase - Jordan, The dissecting Mechanism of RNAi - Osaretinmwen, Dissecting the Mechanism of RNAi - Joshua, The making of an mRNA -Jayden, Prions **Lunch Talk Interviews** Choose a speaker, and the review the link to that persons laboratory/biography in the [agenda](https://jasonjwilliamsny.github.io/stars-2021/agenda/). Prepare one question about their work, and one question you'd like to know about their personal background. 3-4 persons can be assigned for a speaker See also the Students Talk Science Project: [link](https://dnalc.cshl.edu/resources/students-talk-science/) Speaker sign ups: - Dr. Trotman [Lab page](https://www.cshl.edu/research/faculty-staff/lloyd-trotman/) **(Due:8/11)** - Initial Student questioners: - Madison - Carlos - Kelly - name - Dr. Jackson [Lab page](http://jacksonlab.labsites.cshl.edu/) - Initial Student questioners: - Lucas - evan - Jayden[](https://) - Nile - Dr. Cheadle [Lab page](https://www.cheadlelab.com/) - Initial Student questioners: - Chrysnell - Osaretinmwen - Julia - Jordan Blake - Madison - Joshua - Dr. Dos Santos [Lab page](http://dossantoslab.labsites.cshl.edu/) - Initial Student questioners: - Kelly - Camille - Gentiva - Madison - Chrysnell Bring in a plant sample (Due:8/11) - A leaf from a plant you wish to identify. - try to identify using [the seek app](https://www.inaturalist.org/pages/seek_app) **Final Presentation Topic Areas** Please pick ONE area to contribute to a final presentation on. The presentation will be 10 or fewer slides on this topic. We will discuss how to create engaging presentations - but remember they should tell a story, make use of compelling visuals, and (when about science) clearly present data. Lab presentations should give enough context that a non-expert (perhaps your family) will be able to understand the work and its importance. Most groups will have two, but up to three are permissible. *Restriction Enzyme Lab* - Lucas - Evan - Jayden *Bacterial Transformation Lab* - Camille - Julia *Human mitochondrial sequencing Lab* - Madison - Carlos *DNA Barcoding Lab* - Gentiva - Kenly *Computer coding work* - Nile - Osaretinmwen *Guest speakers* - Kelly - Chrysnell *College day* - Joshua -Jordan ---- **Poster Assignment** See also:[link](https://jasonjwilliamsny.github.io/stars-2021/science_topics/writing_labs/) Topic: Bacterial Transformation Background and introduction Hypothesis Summary abstract Data and results: What did you find Discussion Reference citation # BioCoding Work **Variables names exercise** - avg_weight,grp_nm - avg_mass_mice_grp - avg_wght_mice_grp - num_mice - avg_mass, grp_num - avg_gram - mass_avg - avg_mass, mice_num - avg_mass, mice_pg - avg_weight_mice_grp - avg_height - M_avg_mass, M_gp_num - AvgW,NumMice - mice_num - no._mice - alpha_avg_wght, Mou_Pool_alpha **Reverse printing exercise** print(alpha_id[7]),print(alpha_id[6]),print(alpha_id[5]),print(alpha_id[4]),print(alpha_id[3]),print(alpha_id[2]),print(alpha_id[1]),print(alpha_id[0]) print(alpha_id[7]) print(alpha_id[6]) print(alpha_id[5]) print(alpha_id[4]) print(alpha_id[3]) print(alpha_id[2]) print(alpha_id[1]) print (alpha_id[7]) print (alpha_id[6]) print (alpha_id[5]) print (alpha_id[4]) print (alpha_id[3]) print (alpha_id[2]) print (alpha_id[1]) print (alpha_id[0]) **Group ID challenge** ``` alpha_id = 'CGJ28371' beta_id = 'SJW99399' gamma_id = 'PWS29382' ``` ``` alpha_initials= print(my_string[2:7:4]) beta_initials= print(my_string[18:8:-9]) gamma_initials= print(my_string[15:23:7]) ``` ``` alpha_initials = (alpha_id[0:3]) beta_initials = (beta_id[0:3]) gamma_initials = (gamma_id[0:3]) print(alpha_initials) print(beta_initials) print(gamma_initials) ``` ``` alpha_id = 'CGJ28371' beta_id = 'SJW99399' gamma_id = 'PWS29382' alpha_initial=alpha_id[0:3:1] beta_initial=beta_id[0:3:1] gamma_initial=gamma_id[0:3:1] print(alpha_initial) print(beta_initial) print(gamma_initial) alpha_id = 'CGJ28371' beta_id = 'SJW99399' gamma_id = 'PWS29382' ``` ``` print(alpha_id[:3:]) print(beta_id[:3:]) print(gamma_id[:3:]) ``` ``` alpha_initials = alpha_id[0:3] print(alpha_initials) ``` ``` alpha_initials = (alpha_id[0:3]) beta_initials = (beta_id[0:3]) gamma_initials = (gamma_id[0:3]) alpha_id = 'CGJ28371' beta_id = 'SJW99399' gamma_id = 'PWS29382' print(alpha_id[0:3:1]) print(beta_id[0:3:1]) print(gamma_id[0:3:1]) print(alpha_id[4::1]) print(beta_id[4::1]) print(gamma_id[4::1]) print(alpha_initials) print(beta_initials) print(gamma_initials) ``` ``` alpha_initials = (alpha_id[0:3]) beta_initials = (beta_id[0:3]) gamma_initials = (gamma_id[0:3]) ``` ``` print(alpha_initials) print(beta_initials) print(gamma_initials) ``` ``` print(alpha_id[3:9]) print(beta_id[3:9]) print(gamma_id[3:9]) ``` ---- **Fasta Printer** ``` sequence_name= "sequence 001" my_sequence= "ACTATCATTTATCTCTCTATATCGTF" print(">" + sequence_name + "\n" + my_sequence) ``` ``` carlinase = 'my_sequence' sequence01 = "actgagcctagctttagctaacgctctagatagctgatcgctctatata" print( '>'+'carlinase' + "\n"+ sequence01 ) ``` sequence_name = ">myseq" my_sequence = "actggtacgctcgagatctcgctcaactcaagctcga" print(sequence_name + "\n" + my_sequence) ``` sequence_1 sequence_1= "atcgatcgatcgatcgactcgactcgactcgactcgcatcgacataacacaaacgtctctctctgcgtacggctacgagctcgacggctagctcgctag" print (">" + "sequence_1" + "\n" + sequence_1) ``` ``` my_sequence = "ATTCGAGGATCGATTTCGATCGATGCTTAGCTTTAGCTTTTTTAGATCTCCCA" my_sequencename = "n_sequence" print("n_sequence" + my_sequence) ``` ``` sequence001='>sequence001\n' sequence = "ACTGGAAGATGAAT" print(sequence001+sequence) ``` my_sequence = 'atcgagtcag' my_sequence2 = ">1245676543456" print(my_sequence + "\n" + my_sequence2) ``` ``` **Lower case printing** ``` my_uppercase_string = 'ABCDEFG' print (my_uppercase_string.lower()) ``` ``` print("hi".upper()) ``` ``` print("ABCDEFG".lower()) print(hiv_genome.count) ``` ``` my_uppercase_string = 'ABCDEFG' print(my_uppercase_string.lower()) ``` ``` my_uppercase_string = 'ABCDEFG' print(my_uppercase_string.lower()) ``` ``` my_uppercase_string= 'ABCDEFG' print (my_uppercase_string.lower()) ``` ---- **HIV Genome First Look** *Determine and print the length of the HIV genome* len(hiv_genome) print(hiv_genome) print(len(hiv_genome)) len(hiv_genome) *Create variables for and print the sequences for the following HIV genes* *gag* print(hiv_genome[790:2292:1]) gag = 'hiv_genome[790:2292]' ``` gag_sequence= (hiv_genome[790:2293]) print(gag_sequence) ``` ... gag = hiv_genome[790:2292] print(gag+'\n') ... ``` gag = (hiv_genome[790:2292]) print(gag) ``` gag = (hiv_genome[790:2291]) gag = hiv_genome[790:2292] print(gag) gag=hiv_genome[790:2292] ``` gag= hiv_genome[790:2292] print(gag) ``` ''' gag = hiv_genome[791:2293] pol = hiv_genome[2086:5097] vif = hiv_genome[5042:5620] vpr = hiv_genome[5560:5971] env = hiv_genome[6226:8796] print(gag +'\n') print(pol + '\n') print(vif + '\n') print(vif + '\n') print(env + '\n') ''' **Printing List Elements** print(hiv_gene_names[1]) print(hiv_gene_names[3]) print(hiv_gene_names[2]) print(hiv_gene_names[4]) print(hiv_gene_names[0]) print(hiv_gene_names[5]) print(hiv_gene_names[6]) print(hiv_gene_names[1]) print(hiv_gene_names[3]) print(hiv_gene_names[2]) print(hiv_gene_names[4]) print(hiv_gene_names[5]) print(hiv_gene_names[0]) print(hiv_gene_names[6]) print(hiv_gene_names[1]) print(hiv_gene_names[3]) print(hiv_gene_names[2]) print(hiv_gene_names[4]) print(hiv_gene_names[5]) print(hiv_gene_names[0]) print(hiv_gene_names[6]) ``` print(hiv_gene_names[1]),print(hiv_gene_names[3]),print(hiv_gene_names[2]),print(hiv_gene_names[4]),print(hiv_gene_names[5]),print(hiv_gene_names[0]),print(hiv_gene_names[6]) ``` **Simulate coin flip** ``` chaos = random.ranf() if chaos>=0.5: print('Heads') else: print('Tails') ``` ``` my_random_float = random.ranf() if my_random_float >= 0.5: print('Heads') else: print("Tails") ``` ``` random_float= random.ranf() if random_float >= 0.5: print("heads") else: print("tails") ```

Syntax	Example	Reference
# Header	Header	基本排版
- Unordered List	Unordered List
1. Ordered List	Ordered List
- [ ] Todo List	Todo List
> Blockquote	Blockquote
Bold font	Bold font
Italics font	Italics font
~~Strikethrough~~	~~Strikethrough~~
19^th^	19^th
H~2~O	H₂O
++Inserted text++	Inserted text
==Marked text==	Marked text
[link text](https:// "title")	Link
![image alt](https:// "title")	Image
`Code`	`Code`	在筆記中貼入程式碼
```javascript var i = 0; ```	`var i = 0;`
:smile:		Emoji list
{%youtube youtube_id %}	Externals
$L^aT_eX$	L^aT_eX
:::info This is a alert area. :::	This is a alert area.