# Downloading Public SRA Data from NCBI
By Tanya Lama

1. Browse SRA database using data access (public) source (DNA) type (genome) and taxon "mammals"[orgn:__txid40674])) NOT "Homo sapiens"[orgn:__txid9606]
2. We've found 10 runs of low-coverage (2X) whole genome data for alpaca (Vicunga pacos) (paired end WGS library on Illumina)
https://www.ncbi.nlm.nih.gov/sra/SRX172662[accn]
4. To access the first run of this data (SRR530974) we will need to download the SRA toolkit
5. For Mac OS: visit https://www.ncbi.nlm.nih.gov/Traces/sra/?view=software
6. Double-click on the .tar.gz file and the Archive Utility will unpack it.
7. Open a terminal prompt and "cd" change directory into the folder containing the toolkit executables

    cd /Users/tanyalama/sratoolkit.2.9.6-1-mac64/bin/

8. Execute the following command to download your desired run (Note: SRR###### corresponds with your run number SRR530974)

    ./fastq-dump -X 5 -Z SRR530974

9. If successful, the test should connect to NCBI, download a small amount of data from SRR530974 and the reference sequence needed to extract the data, and stream the first 5 spots of the file (-X 5 option) to the screen (-Z option):

Read 1 spots for SRR530974
Written 1 spots for SRR530974
@SRR530974.1 GZ6X3B103GR5YE length=364
TCAGGGTTTTTGGAAGATGTTTCACAAAGGACCTTAATTTTCACTGTTAAACAGTAAGGCAAGCTTGTATTCTCCACTTTGCTTAGCTGACAGCCAAGGAATTAAATTATTAGAACAGCCTTCAAGTGATTGTTCATTCAAGTATCTACTGAGCATCTTACTTTGTGCCAGGCACTATGTTAGGGATACTCAGGGAACAAAACACAGACTCCCTGTCGTCATGGAACTTGCAGCTGCTGTACGGCCAAGGCGGATGTACGGTACAGCAGCTGTTTTGTAAATAAGATCATTTGTGTCCTTTTAAGGATTTCACATATATGTGATATCATATGCTGAGACTGCCAAGGCACACAGGGGATAGGNN
+SRR530974.1 GZ6X3B103GR5YE length=364

11. The SRA file should be downloaded to `/Users/tanyalama/ncbi/public `
but you should check the`/Users/tanyalama/sratoolkit.2.9.6-1-mac64/bin/` folder for files too.
13. Your file is listed in fastq format as `/Users/tanyalama/ncbi/public/sra/SRR530974.fastq`
14. Download the Alpaca refererence assembly: ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/164/845/GCF_000164845.2_Vicugna_pacos-2.0.2
13. Select the `.fna.gz `file and download to ncbi/public

###### tags: `tools` `Basic` `Documentation` `Genomics` `Conservation Genomics`