---
tags: ebook
---

# DNA Barcoding

This protocol can be used for the sequencing of any amplicon using a rapid method. However, the focus of this page is for the multiplexed sequencing of DNA barcodes for the identification of taxa.

:::warning
DNA Barcoding refers to the use of universal sequences (DNA barcodes) that can identify taxa. Barcodes also refer to short unique DNA sequences that are added to DNA samples prior to pooling DNA in order to identify each sample in the downstream analysis (i.e PCR-cDNA Barcoding Kit). Because of these two uses of "barcoding" this protocol will refer to the second type of barcode mentioned as an index.
:::

For DNA barcoding in a classroom, Nanopore library prep kits come with sets of 24 indexed primers, typically enough for 6 reactions. Amplicons with unique barcodes can be pooled and sequenced together on one flongle. The four primer protocol described here is adapted from the nanopore found [here](https://community.nanoporetech.com/docs/prepare/library_prep_protocols/nested-pcr-protocol/v/ffp_9038_v108_revw_14aug2019/overview-of-the-rapid-sequ?devices=minion) (you must be signed in to view).

### Requirements:

1. Barcoding primers (with nanopore sequences shown below)
2. [PCR-cDNA Barcoding Kit](https://store.nanoporetech.com/us/cdna-pcr-barcoding-sequencing-kit-1.html)
SQK-PCB111.24
4. Flongle flow cell

##### DNA extraction Methods can be found at [DNA Barcoding 101](https://duckduckgo.com)

:::info
##### Add these flanking sequences to your primers
Forward primer: 5’ – TTTCTGTTGGTGCTGATATTGC – your primer sequence – 3’

Reverse primer: 5’ – ACTTGCCTGTCGCTCTATCTTC – your primer sequence – 3’
:::

For inner primer follow the protocols on [DNA Barcoding 101](https://dnabarcoding101.org/lab/protocol-2.html)