---
tags: virus, spillover
---

Spillover: sequence info/context
===

## PREDICT sequences
[A Strategy To Estimate Unknown Viral Diversity in Mammals (2013)](https://journals.asm.org/doi/full/10.1128/mBio.00598-13) - 12,793 new viruses in 9 different families (>1000 per family)
> virus was considered novel if thesequence identity to its closest relative was less than or equal to the identity between the two closest species for a given viral family
> 12,793 viruses:
> - coronaviruses (CoVs; n 1,631)
> - paramyxoviruses (PMVs; n 1,108)
> - hantaviruses (HTVs; n 1,108)
> - astroviruses (AstVs; n 1,348)
> - influenza A viruses (IFAVs; n 1,108)
> - bocaviruses (BoVs; n 1,739)
> - adenoviruses (AdVs; n 1,902)
> - herpesviruses (HVs; n 1,741)
> - polyomaviruses (PyVs; n 1,108
> GenBank accession numbers for viruses discovered in this study are KC692400 to KC692452 **(52 acc's)**

### What are the sequences?

> PCR with degenerate viral family-level primers to discover and analyze the occurrence patterns of 55 viruses from nine viral families.

> Total nucleic acid was extracted from all samples using the EasyMag (bioMérieux, Inc.) platform, and cDNA synthesis performed using SuperScript III first-strand synthesis supermix (Invitrogen), all according to the manufacturer’s instructions. Viral discovery was performed using broadly reactive consensus PCR assays targeting coronaviruses (49), paramyxoviruses (50), astroviruses (51), influenza A viruses (38), adenoviruses (52), polyomaviruses (53), bocaviruses (54), and herpesviruses (55). Consensus primers for hantaviruses were modified from an existing protocol (56) in order to increase the degeneracy of the assay, and the assay validated for its ability to detect diverse hantaviruses, including Andes, Puumala, Sin Nombre, Prospect Hill, Seoul, and Thottapalayam hantaviruses. The modified primer sequences were UHantaF1 (GWGGVCARACWGCHGAYT) and UHantaR1 (CCW GGTGTDADYTCHTCWGC) (expected amplicon, 250 bp), and the annealing temperature was 52°C. All PCR products of the expected size were cloned into Strataclone PCR cloning vector, and 12 white colonies se- quenced using standard M13R primers.

PCR Reference Info:
- coronaviruses [Identification of a Severe Acute Respiratory Syndrome Coronavirus-Like Virus in a Leaf-Nosed Bat in Nigeria](https://journals.asm.org/doi/10.1128/mBio.00208-10)
> consensus PCRs of a 400-nucleotide (nt) fragment of the RNA-dependent RNA polymerase (RdRp) gene
- paramyxoviruses [Sensitive and broadly reactive reverse transcription-PCR assays to detect novel paramyxoviruses (2008)](https://journals.asm.org/doi/full/10.1128/JCM.00192-08)
> RNA polymerase (L) coding sequences were the most conserved, and thus, this gene was selected as the locus for the broadly reacting PCR assays.
> - Non-segmented negative strand RNA viruses belonging to the Mononegavirales order possess **RNA-dependent RNA polymerase L proteins** within viral particles. The L protein is a multifunctional enzyme catalyzing viral RNA synthesis and processing (i.e., mRNA capping, cap methylation, and polyadenylation).
> == RdRp, but different version (L)? or diff region?
- astroviruses [Characterization of an outbreak of astroviral diarrhea in a group of cheetahs](https://www.sciencedirect.com/science/article/pii/S0378113508004896?casa_token=B4oQ6g5ndx4AAAAA:G4C32L8L_IhlTYL3iDzo72C8Pz-jnh2r7VcP9VG0QdFetk4I14pkcryh_S7KBFQrG0_XAnHm)
> Degenerate primers were designed targeting conserved regions in the RNA-dependent-RNA polymerase (RdRp) and the capsid protein. The astrovirus was confirmed and sequenced using consensus astroviral PCR, resulting in a 367 base pair partial RNA-dependent-RNA polymerase (RdRp) product and a 628 base pair partial capsid gene product.
- influenza A viruses [Emergence of fatal avian influenza in New England harbor seals](http://dx.doi.org/10.1128/mBio.00166-12)
> PCR for the detection of influenza A virus was performed using primers FLUAV-M-U44 (GTCTTCTAACCGAGGTCGAAACG) and FLUAV-M-L287 (GCATTTTGGACAAAGCGTCTACG), to produce a 243-bp product of segment 7 (coding for matrix protein). For full-genome sequencing, full-length cDNAs were amplified for all eight influenza segments. Primers were designed to target terminal sequences for each segment, based on alignments of avian, canine, and equine H3N8 sequences from the Influenza Research Database (http://www.fludb.org).
- adenoviruses [Detection and analysis of six lizard adenoviruses by consensus primer PCR provides further evidence of a reptilian origin for the atadenoviruses](https://journals.asm.org/doi/full/10.1128/JVI.78.23.13366-13369.2004)
> Nested-PCR amplification of a partial sequence of the adenoviral DNA polymerase gene was performed. (==DNAP?)
- polyomaviruses [Novel polyomavirus
detected in the feces of a chimpanzee by nested broad-spectrum PCR](https://journals.asm.org/doi/full/10.1128/JVI.79.6.3883-3887.2005)
> PCR amplifying a 195-bp fragment of the ChPyV VP1 gene was developed by using primers ChPyV-s (5′-TTTCAGCTGCTGATATCTGTGGT-3′) and ChPyV-as (5′-TCTGGGCCTGTCATAGGTTGTC-3′). Only the cloned ChPyV sequence, and no DNA of nine other polyomaviruses (Fig. 1B), was amplified by this PCR.
- bocaviruses [Identification and characterization of a new bocavirus species in gorillas](https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0011948)
> PCR primers panBOV-F1 (5′-TAATGCAYCARGAYTGGGTIGANCC -3′) and panBOV-R1 (5′- GTACAGTCRTAYTCRTTRAARCACCA-3′) were used for the first round of hemi-nested PCR; while primers panBOV-F2 (5′- GCAYCARGAYTGGGTIGANCCWGC – 3′) and panBOV-R1 (same as first round) were used for the second round of hemi-nested PCR
> To increase the sensitivity of the PCR specific primers targeting the same conserved gene region were used to screen all 23 samples. PCR primers GBoV-F1 (5′- GCACCAAGACTGGGTGGAACC – 3′) and GBoV-R1(5′- GCACCAGTGTAGTAGAGCTGC- 3′) were used for the first round of nested PCR. Primers GBoV-F2 (5′- CAAGACTGGGTGGAACCAGC-3′) and GBoV-R2(5′- GCACCAGTGTAGTAGAGCTGCAAT- 3′) were used for the second round.
> Complete genome of the GBoV1 was acquired using primer walking approach as previously described [11]. In brief, each extension step of PCR used one primer specific for the novel virus sequence and other degenerated to hybridize all known bocavirus sequences. After the complete genome was assembled, each base is sequenced in triplicate to confirm the sequence. The near complete genome of GBoV1 is submitted to Genbank under accession number HM145750.
- herpesviruses [Detection and analysis of diverse herpesviral species by consensus primer PCR](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC229091/)
> A consensus primer PCR method which amplifies a region of herpesviral DNA-directed DNA polymerase (EC 2.7.7.7) and which uses degenerate primers in a nested format was developed. **Primers were designed to target sequences coding for highly conserved amino acid motifs covering a region of approximately 800 bp.** The assay was applied to 22 species of herpesviruses (8 human and 14 animal viruses), with PCR products obtained for 21 of 22 viruses. In the process, 14 previously unreported amino acid-coding sequences from herpesviral DNA polymerases were obtained, including regions of human herpesviruses 7 and 8. The 50 to 60 amino acid-coding sequences recovered in the present study were determined to be unique to each viral species studied, with very little sequence variation between strains of a single species when studied.