# BI332L Fall 2019 Primers Primer names encode the target species and gene name, as well as the primer positions and directions. They are organized by model species and grouped as pairs of forward and reverse primers for each target gene. (Note the F and R in the primer names.) The amplicon (or product size) is given in base pairs (bp). An order for these primers was submitted to [MilliporeSigma](https://www.sigmaaldrich.com/pc/ui/tube-bulk-entry?product=standard) on 17 November 2019. ## Zebrafish (*Danio rerio*) Primers for the referebce gene glucose-6-phosphate dehydrogenase (*g6pd*) and genes of interest, *Sox9a* and *fgf8a*. | primer name | sequence | amplicon | source | | --------------- | --------------------------- |:--------:| ------------------------------------------------------------ | | Drer-g6pd-1069F | GTCCCGAAAGGCTCCACTC | 124 | [Filby et al. 2007](https://bmcmolbiol.biomedcentral.com/articles/10.1186/1471-2199-8-10) | | Drer-g6pd-1192R | CCTCCGCTTTCCTCTC | | | | Drer-Sox9a-F22 | AGCACATCAGCTACGGTTCCTTCA | 144 | [Sun et al. 2013](https://www.nature.com/articles/cddis2013456) | | Drer-Sox9a-R22 | TCTGACCTCCAGCATGGGTGTAAT | | | | Drer-fgf8a-349F | CATATGTTGCGAGTCACAGTGTGGA | 194 | [Stulberg et al. 2012](https://dx.doi.org/10.1016%2Fj.ydbio.2012.07.003) | | Drer-fgf8a-542R | TGGTTACCTGAGCATAGTAGCAAAACG | | | ## Chick (*Gallus gallus*) Primers for reference gene $\beta$-actin (*atcb*) and gene of interest *sonic hedgehog* (*ssh*). | primer name | sequence | amplicon | source | | --------------- | --------------------------- |:--------:| ------------------------------------------------------------ | | Ggal-actb-408F | GCCAACAGAGAGAAGATGACAC | 140 | [Zhang et al. 2010](https://dx.doi.org/10.4061%2F2010%2F373241) | | Ggal-actb-547R | GTAACACCATCACCAGAGTCCA | | | | Ggal-shh-449F | CCCCAAATTACAACCCTGACAT | 115 | [Boije et al. 2012](https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0050890) | | Ggal-shh-563R | TTCATCACCGAGATCGCCA | | | ## Fruit fly (*Drosophila melanogaster*) Primers for reference gene *ribosomal protein (large subunit) 32* (*rpL32*, a.k.a. *rp49*) and genes of interest *Methoprene tolerant* (*Met*), *chicadee* (*chic*), *wishful thinking* (*wit*), and *yolk protein 1* (*yp1*). Flies have 3 "yolk proteins", which are orthologs of vitellogenin. I chose to look at expression of Yp1, since it has the highest expression in adult ovaries ([Williams & Bownes 1986](https://doi.org/10.1111/j.1432-1033.1986.tb10128.x)). | primer name | sequence | amplicon | source | | --------------- | --------------------------- |:--------:| ------------------------------------------------------------ | | Dmel-RpL32-171F | CGGTTACGGATCGAACAAGC | 154 | [Ahmad et al. 2012](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3552313/) | | Dmel-RpL32-324R | CTTGCGCTTCTTGGAGGAGA | | | | Dmel-Met-n92F | AGGCGCCAATTAAAGGGGAA | 158 | [Barry et al 2008](https://doi.org/10.1016/j.ibmb.2007.12.001) | | Dmel-Met-66R | GTGAGCTACCAATTACGTCCA | | | | Dmel-chic-n71F | AACAGCGATCCATATCCAGATCC | 98 | Dr.A. | | Dmel-chic-27R | GGTTGTCCACATAATCTTGCCAG | | | | Dmel-wit-222F | TTCTGTTTCACCATCTGGAACCA | 65 | Dr.A. | | Dmel-wit-286R | TTCCAGCAACCCTGTTTAACAAC | | | | Dmel-yp1-366F | TGAGGATGAGGTGACCATCATTG | 106 | Dr.A. | | Dmel-yp1-471R | CAGATTGTAGCGCTGCATGTAAG | | | ## Painted lady (*Vanessa cardui*) These primers are intended to verify gene editing for two of our target sgRNAs, T7-Vc-WntA-354-Cas9sg and T7-Vc-EGFR-364-Cas9sg. | primer name | sequence | amplicon | source | | --------------- | --------------------------- |:--------:| ------------------------------------------------------------ | | Vc-WntA-237F | GCAAGCTGTCGAAGAATGTCAG | 474 | Dr.A. | | Vc-WntA-710F | TCACCCACGATCCTTAGTTGTG | | | | Vc-EGFR-192F | CACGCATTACAGAAATTTGCGC | 433 | Dr.A. | | Vc-EGFR-624R | CGGACATTCTCTCTCAGGTACG | | |
×
Sign in
Email
Password
Forgot password
or
By clicking below, you agree to our
terms of service
.
Sign in via Facebook
Sign in via Twitter
Sign in via GitHub
Sign in via Dropbox
Sign in with Wallet
Wallet (
)
Connect another wallet
New to HackMD?
Sign up