scripts for read highlighting

# scripts for read highlighting ## 1. Highlight full construct in reads shorter than expected ```Shell! GREP_COLORS='mt=01;33' zgrep --color=always "GG$A\|T$AC$A\|T$GG$A\|T$TGAAC$A\|T$GT$A\|T$TA$T\|C$CC$T\|C$CC" Undetermined_S0_L001_R1_001.fastq.gz | GREP_COLORS='mt=04;31' grep --color=always "TG$A\|G$TT$T\|C$TT$T\|C$GGTCA$T\|C$CCTGA$A\|G$GTTTA" | GREP_COLORS='mt=04;35' grep --color=always "ATCTCGTATGCCGTCTTCTGCTTG" | GREP_COLORS='mt=04;38;5;34' grep --color=always "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" ``` pipe the following for counting the selected sequences ```bash wc -l ``` ## 2. Extract PCR(1) product ```Bash! GREP_COLORS='mt=01;33' zgrep --color=always "GG$A\|T$AC$A\|T$GG$A\|T$TGAAC$A\|T$GT$A\|T$TA$T\|C$CC$T\|C$CC" Undetermined_S0_L001_R1_001.fastq.gz | GREP_COLORS='mt=04;31' grep --color=always "TG$A\|G$TT$T\|C$TT$T\|C$GGTCA$T\|C$CCTGA$A\|G$GTTTA" | sed 's/GG\$A\|T$AC$A\|T$GG$A\|T$TGAAC$A\|T$GT$A\|T$TA$T\|C$CC$T\|C$CC//g; s/TG$A\|G$TT$T\|C$TT$T\|C$GGTCA$T\|C$CCTGA$A\|G$GTTTA.*$//g' ``` Pipe the following to extract sequences of specified size (81 in the example) ```bash awk '{if (length-28 == 81) print}' ``` Pipe the following for a size histogram ```bash! awk '{print length-28}' | sort -g | uniq -c ``` ## 3. Color and Style conversion table ### Styling ``` ┏━━━━━┳━━━━━━━━━━━━━━━━━━━━━━━━━┳━━━━━━━━━━━━━━━━━━━━━━━━━┳━━━━━━━━━━━━━━━━━━━━━━━┓ ┃ ### ┃ GNOME Terminal ┃ xterm ┃ non-GUI TTY ┃ ┡━━━━━╇━━━━━━━━━━━━━━━━━━━━━━━━━╇━━━━━━━━━━━━━━━━━━━━━━━━━╇━━━━━━━━━━━━━━━━━━━━━━━┩ │ │ «reset style+colors» │ «reset style+colors» │ «reset style+colors» │ │ 0 │ «reset style+colors» │ «reset style+colors» │ «reset style+colors» │ ├─────┼─────────────────────────┼─────────────────────────┼───────────────────────┤ │ 1 │ +bold, +brighter color │ +bold, +brighter color │ +brighter color, │ │ │ │ │ -forced grey │ │ 2 │ +fainter color │ +fainter color │ +forced grey │ │ 3 │ +italic │ +italic │ +forced green │ │ │ │ │ ● overrides 2 and 4 │ │ 4 │ +underline │ +underline │ +forced cyan │ │ │ │ │ ● overrides 2 │ │ 5 │ «no effect» │ +blink │ «no effect» │ │ 7 │ +invert colors │ +invert colors │ +invert colors │ │ 8 │ +invisible │ +invisible │ «no effect» │ │ │ │ ● underline appears │ │ │ 9 │ +strikethrough │ +strikethrough │ «no effect» │ ├─────┼─────────────────────────┤ ├───────────────────────┤ │ 21 │ -bold, -brighter color, │ +double underline │ -brighter color, │ │ │ -fainter color ├─────────────────────────┤ -forced grey │ │ 22 │ -bold, -brighter color, │ -bold, -brighter color, │ -brighter color, │ │ │ -fainter color │ -fainter color │ -forced grey │ │ 23 │ -italic │ -italic │ -forced green │ │ 24 │ -underline │ -underline, │ -forced cyan │ │ │ │ -double underline │ │ │ 25 │ «no effect» │ -blink │ «no effect» │ │ 27 │ -invert colors │ -invert colors │ -invert colors │ │ 28 │ -invisible │ -invisible │ «no effect» │ │ 29 │ -strikethrough │ -strikethrough │ «no effect» │ └─────┴─────────────────────────┴─────────────────────────┴───────────────────────┘ ``` ### Coloring ``` ┏━━━━━┳━━━━━━━━━━━━━━━━━━━━━━━━━┳━━━━━━━━━━━━━━━━━━━━━━━━━┳━━━━━━━━━━━━━━━━━━━━━━━┓ ┃ ### ┃ GNOME Terminal ┃ xterm ┃ non-GUI TTY ┃ ┡━━━━━╇━━━━━━━━━━━━━━━━━━━━━━━━━╇━━━━━━━━━━━━━━━━━━━━━━━━━╇━━━━━━━━━━━━━━━━━━━━━━━┩ │ 39 │ «reset this color» │ «reset this color» │ «reset this color» │ ├─────┼─────────────────────────┼─────────────────────────┼───────────────────────┤ │ 30 │ very dark grey │ black │ black │ │ 31 │ dull red │ red │ light red │ │ 32 │ dull green │ light green │ light green │ │ 33 │ dull yellow │ yellow │ yellow │ │ 34 │ greyish blue │ dark blue │ sky blue │ │ 35 │ dull purple │ purple │ purple │ │ 36 │ teal │ cyan │ cyan │ │ 37 │ light grey │ light grey │ light grey │ ├─────┼─────────────────────────┼─────────────────────────┼───────────────────────┤ │ 90 │ dark grey │ dull grey │ dull grey │ │ 91 │ red │ bright red │ bright red │ │ 92 │ lime green │ bright green │ bright green │ │ 93 │ yellow │ bright yellow │ pure yellow │ │ 94 │ light greyish blue │ dull blue │ deep blue │ │ 95 │ light purple │ magenta │ magenta │ │ 96 │ cyan │ bright cyan │ bright cyan │ │ 97 │ off white │ white │ white │ ├─────┴──────┬──────────────────┴─────────────────────────┴───────────────────────┤ │ 38;2;ʀ;ɢ;ʙ │ replace ʀ, ɢ, and ʙ with RGB values from 0 to 255 │ │ │ for closest supported color (non-GUI TTY has only 16 colors!) │ │ 38;5;ɴ │ replace ɴ with value from 256-color chart below │ │ │ for closest supported color (non-GUI TTY has only 16 colors!) │ └────────────┴────────────────────────────────────────────────────────────────────┘ ```